matlab software matpiv Search Results


96
MathWorks Inc matlab software package
Matlab Software Package, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+software+matpiv/pm23978687-110-16-16?v=MathWorks+Inc
Average 96 stars, based on 1 article reviews
matlab software package - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

90
GraphPad Software Inc prism graphpad v8.03
Prism Graphpad V8.03, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+software+matpiv/pmc08110786__41467_2021_22873_MOESM10_ESM-12-65-66?v=GraphPad+Software+Inc
Average 90 stars, based on 1 article reviews
prism graphpad v8.03 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

99
Nikon 2021 nikon imaging software elements 5 02 03
2021 Nikon Imaging Software Elements 5 02 03, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+software+matpiv/pmc08110786__41467_2021_22873_MOESM10_ESM-12-44-45?v=Nikon
Average 99 stars, based on 1 article reviews
2021 nikon imaging software elements 5 02 03 - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier

98
Addgene inc 2003 n a pspax2
2003 N A Pspax2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+software+matpiv/pm32497487-282-18-26?v=Addgene+inc
Average 98 stars, based on 1 article reviews
2003 n a pspax2 - by Bioz Stars, 2026-07
98/100 stars
  Buy from Supplier

93
Addgene inc 1998 n a pgp akagi
1998 N A Pgp Akagi, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+software+matpiv/pm32497487-282-12-26?v=Addgene+inc
Average 93 stars, based on 1 article reviews
1998 n a pgp akagi - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

90
Addgene inc uas rasv12 gd 47181 oligonucleotides minicicf atcgctgcgtgcgcgcttaggcggcc gcaacatgccaaaaaagaagagaaaggtatccg cctccggagggggcgtggtc
Uas Rasv12 Gd 47181 Oligonucleotides Minicicf Atcgctgcgtgcgcgcttaggcggcc Gcaacatgccaaaaaagaagagaaaggtatccg Cctccggagggggcgtggtc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+software+matpiv/pmc06331351__mmc8-221-69-102?v=Addgene+inc
Average 90 stars, based on 1 article reviews
uas rasv12 gd 47181 oligonucleotides minicicf atcgctgcgtgcgcgcttaggcggcc gcaacatgccaaaaaagaagagaaaggtatccg cctccggagggggcgtggtc - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

94
Addgene inc tol2 -8.4neurog
Tol2 8.4neurog, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+software+matpiv/pm36841243-250-17-30?v=Addgene+inc
Average 94 stars, based on 1 article reviews
tol2 -8.4neurog - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

95
Addgene inc pt3tsncas9n addgene addgene 46757 plasmid
Pt3tsncas9n Addgene Addgene 46757 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+software+matpiv/pm36841243-250-29-30?v=Addgene+inc
Average 95 stars, based on 1 article reviews
pt3tsncas9n addgene addgene 46757 plasmid - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

Image Search Results