96
|
MathWorks Inc
matlab software package Matlab Software Package, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/matlab+software+matpiv/pm23978687-110-16-16?v=MathWorks+Inc Average 96 stars, based on 1 article reviews
matlab software package - by Bioz Stars,
2026-07
96/100 stars
|
Buy from Supplier |
90
|
GraphPad Software Inc
prism graphpad v8.03 Prism Graphpad V8.03, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/matlab+software+matpiv/pmc08110786__41467_2021_22873_MOESM10_ESM-12-65-66?v=GraphPad+Software+Inc Average 90 stars, based on 1 article reviews
prism graphpad v8.03 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
99
|
Nikon
2021 nikon imaging software elements 5 02 03 2021 Nikon Imaging Software Elements 5 02 03, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/matlab+software+matpiv/pmc08110786__41467_2021_22873_MOESM10_ESM-12-44-45?v=Nikon Average 99 stars, based on 1 article reviews
2021 nikon imaging software elements 5 02 03 - by Bioz Stars,
2026-07
99/100 stars
|
Buy from Supplier |
98
|
Addgene inc
2003 n a pspax2 2003 N A Pspax2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/matlab+software+matpiv/pm32497487-282-18-26?v=Addgene+inc Average 98 stars, based on 1 article reviews
2003 n a pspax2 - by Bioz Stars,
2026-07
98/100 stars
|
Buy from Supplier |
93
|
Addgene inc
1998 n a pgp akagi 1998 N A Pgp Akagi, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/matlab+software+matpiv/pm32497487-282-12-26?v=Addgene+inc Average 93 stars, based on 1 article reviews
1998 n a pgp akagi - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
90
|
Addgene inc
uas rasv12 gd 47181 oligonucleotides minicicf atcgctgcgtgcgcgcttaggcggcc gcaacatgccaaaaaagaagagaaaggtatccg cctccggagggggcgtggtc Uas Rasv12 Gd 47181 Oligonucleotides Minicicf Atcgctgcgtgcgcgcttaggcggcc Gcaacatgccaaaaaagaagagaaaggtatccg Cctccggagggggcgtggtc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/matlab+software+matpiv/pmc06331351__mmc8-221-69-102?v=Addgene+inc Average 90 stars, based on 1 article reviews
uas rasv12 gd 47181 oligonucleotides minicicf atcgctgcgtgcgcgcttaggcggcc gcaacatgccaaaaaagaagagaaaggtatccg cctccggagggggcgtggtc - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
94
|
Addgene inc
tol2 -8.4neurog Tol2 8.4neurog, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/matlab+software+matpiv/pm36841243-250-17-30?v=Addgene+inc Average 94 stars, based on 1 article reviews
tol2 -8.4neurog - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
95
|
Addgene inc
pt3tsncas9n addgene addgene 46757 plasmid Pt3tsncas9n Addgene Addgene 46757 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/matlab+software+matpiv/pm36841243-250-29-30?v=Addgene+inc Average 95 stars, based on 1 article reviews
pt3tsncas9n addgene addgene 46757 plasmid - by Bioz Stars,
2026-07
95/100 stars
|
Buy from Supplier |